Knockdown on aPKC-ι inhibits epithelial-mesenchymal transition, migration and invasion of colorectal cancer cells through Rac1-JNK pathway

Abstract
Atypical protein kinase C-ι (aPKC-ι) is an oncogenic factor, and required for the epithelial- mesenchymal transition (EMT) of different types of cancer. Our study aimed to investigate the role of aPKC-ι in the EMT, migration and invasion of colorectal cancer (CRC) cells. Expression of aPKC-ι was evaluated in CRC cell lines treated with TGF-β1 using qPCR and western blot. After aPKC-ι was knocked down using shRNA, migration and invasion abilities of CRC cell lines were evaluated by wound healing assay and transwell assay, respectively. Activation status of downstream signaling factors of aPKC-ι, including Rac1, JNK, STAT3 and β-catenin, was measured using western blot. Furthermore, auranofin, an aPKC-ι inhibitor, was used to treat CRC cell lines to investigate its possible inhibition on the EMT of CRC cell lines, as well as on the expression of aPKC-ι and its downstream signaling factors. TGF-β1 induced the expression of aPKC-ι in CRC cells, and knockdown on aPKC-ι inhibited the TGF- β1-induced EMT, migration and invasion of CRC cells. Interestingly, Rac1 GTPase level was decreased when aPKC-ι was knocked down, and overexpression of Rac1G12V rescued the cell EMT, migration and invasion in CRC cells as inhibited by sh-aPKC-ι. Moreover, knockdown on aPKC-ι suppressed the phosphorylation of JNK and STAT3, and nuclear translocation of β-catenin. The aPKC- ι inhibitor, Auranofin, showed similar inhibitory effects as aPKC-ι knockdown. Knockdown on aPKC-ι inhibited the EMT, migration and invasion of CRC cells through suppressing of Rac1-JNK pathway. Those findings indicate that aPKC-ι may serve as a novel therapeutic target for CRC.

Introduction
Development of distal metastatic lesions is the main cause of death in colorectal cancer (CRC) patients[1]. Approximately 25% of the CRC patients show metastases when firstly diagnosed, with liver as the most affected organ, and half of the patients develop metastases during the whole disease course[2, 3]. Compared to patients with localized CRC whose 5-year survival rate could approach 90%, those patients with metastatic CRC (mCRC) only have a 5-year survival rate of ~10%[1]. In addition, if left untreated, mCRC patients only have a median overall survival of less than 8 months[4]. Surgery is considered the standard of care for mCRC patients and offers the only potential for cure[5]. However, only 10% ~ 20% of the mCRC patients are initially eligible for surgical treatment, and this number remains less than 40% even after “conversion” therapies[4]. Due to the high metastasis rate in CRC patients and the high mortality rate behind it, it becomes quite necessary to study the underlying mechanism of CRC metastasis and find ways to control it.Epithelial- mesenchymal transition (EMT) is known as the conversion of epithelial cells into cells with mesenchymal phenotype[6]. Firstly known to be involved in embryogenesis and tissue repair, EMT was later found to play a role in the carcinogenesis and metastasis of tumors, including CRC[7, 8]. Indeed, EMT was indicated as a pivotal mechanism of cancer cell invasion, through which tightly- bound epithelial cells acquire an invasive mesenchymal phenotype[9]. The hallmark changes of EMT in molecular level include the down-regulation of epithelial markers e.g. E-cadherin, claudins, α- catenin, γ-catenin, occludin, and the up-regulation of mesenchymal markers, e.g. N-cadherin, vimentin, Snail, the nuclear translocation of β-catenin, and etc., and the underlying pathways include transforming growth factor-β (TGF-β) pathway, Ras- mitogen-activated protein kinase/Snail/Slug pathway, NF-κB pathway, microRN As, and etc[6, 9, 10].

Although many factors as mentioned above (e.g. E-cadherin) were used as immunohistochemistry markers for EMT, β-catenin remains the main oncoprotein of the EMT in CRC, and nuclear translocation of β-catenin serves as an important marker of EMT in CRC cells[6].Protein kinase C (PKC) family is a group of evolutionary-conservedserine/threonine kinases which was involved in different metabolic processes in almost all type of cells, and dysregulation of PKC could lead to different diseases, including diabetes, autoimmune diseases, cancer, and etc.[11]. PKC family could be divided into three subfamilies: conventional PKC (PKC-α, βI, βII and γ), novel PKC (PKC-δ, ε, η, θ), and atypical PKC (PKCζ and ι)[12]. Almost all of those PKC isoforms have been shown to exert cancer-promoting/inhibiting effects in different types of cancer, including breast cancer, colon cancer, lung cancer, pancreatic cancer, prostate cancer, gastrointestinal stromal tumor (GIST), glioma/glioblastoma, head and neck squamous cell carcinoma, hepatocellular carcinoma (HCC), leukemia, lymphoma, and etc.[11]. In addition, several PKC family members have been associated to EMT of tumor cells, e.g. PKC- θ in GIST[13, 14], PKC- ε in breast cancer[15], and etc. In this study, we focused on PKC- ι, a member of atypical PKC, and its roles in EMT of CRC cells.Atypical PKC-ι (aPKC-ι) has been reported to be functionally required for the EMT of different types of cancer, including lung, pancreatic, ovarian, prostate, colon and brain cancer[16]. Previous studies reported that aPKC-ι-Par6 complex could activate Rac1 pathway which drives the transformed growth of non-small-cell lung cancer (NSCLC)[10]. In addition, aPKC-ι was also shown to enhance the phosphorylation of Par6 by TGF-β, therefore facilitating the EMT of the HCC[17, 18].On the other hand, a group of anti-rheumatoid arthritis drugs could inhibit aPKC-ι by influencing its interaction with Par6, which was shown to inhibit the transformed growth of HCC and pancreatic cancer[17, 19-21]. Among those inhibitors, auranofin (ANF) has been widely studied for its application in many type of diseases other than rheumatoid arthritis, including cancer, neurodegenerative diseases, AIDS, parasitic infections and bacterial infections [22].

In several preclinical studies on cancer treatment, ANF has shown treatment effects on NSCLC, ovarian cancer, GIST and various types of leukemia and lymphoma[23-25].Previous study has shown that aPKC-ι was overexpressed in CRC and required for oncogenic transformation and carcinogenesis of CRC[26]. However, the underlying mechanism has not been fully clarified yet. Our study aimed to further investigate the mechanism of aPKC-ι in the tumorigenesis of CRC.Material and methodsSW480 and HCT116 cell lines were purchased from American Type Culture Collection (Manassas, USA) and cultured in RPMI 1640 (Boster, China) with 10% fetal bovine serum (Sigma Aldrich, USA). Cells were kept at 37°C in a humidified atmosphere with 5% CO2 for subsequent analysis. TGF-β1 was purchased from Invitrogen (Thermo Fisher Scientific, USA) and dissolved in PBS with 0.1% bovine serum albumin. TGF-β1 was added to cell culture media at a final concentration of 10 ng/ml, as described in Kong et al. [27]. MTT cytotoxicity assayThe cytotoxicity of ANF on SW480 and HCT116 cell lines was evaluated using 3-(4,5)- dimethylthiahiazo (-z- y1)-3,5-di-phenytetrazoliumromide (MTT) assay as described in Ling et al.[28]. Basically, after reaching the logarithmic growth stage, SW480 and HCT116 cells were treated with ANF (0, 0.1, 0.25, 0.5, 1.0, 2.0, and 5.0 μM), or DMEM (negative control) for 72 h. After the treatment, MTT solution (20 μL, 5 mg/mL) was added and further incubated 4 h at 37 °C. The produced formazan crystals were dissolved by addition of 150 µL DMSO for 10 min. Finally, the absorbance of individual samples was examined at 490 nm.Complete coding sequence of Rac1G12V was obtained from Sangon Biotech (Shanghai, China) and cloned into the pcDNA3.1 vector (Invitrogen, USA). SW480 and HCT116 cell lines were seeded in 6-well culture plates and transfected with 4 μg pcDNA3.1-

Rac1G12V or control pcDNA3.1 vector using 10 μl Lipofectamine 2000 (Invitrogen).Short hairpin RNA (shRNA) targeting aPKC-ι (sh-aPKC-ι) was synthesized by Sangon Biotech (Shanghai, China), with a scramble shRNA (sh-NC) as control. The sequences were as follow, sh- aPKC-ι-1: 5′-CACCGCAATGAGGTTCGAGACATGTTTCAAGAGAACATGTCTCGAACCTCATTGCTTTTTT G-3′, sh-aPKC-ι-2:5′- CACCGCCACACTTTCCAAGC CAAGCTTCAAGA GAGCTTGGCTTGGAAAGTGTGGCTTTTTT G-3′, sh-aPKC-ι-3: 5′- CACCGCACAGACAGTAA TTCCATATTTCAAGAGAA TATGGAATTACTGTCTGTGCTTTTTT G-3′, sh-NC:5′- CACCGTTCTCCGAACGTGT CACGTCAAGAG ATTACGTGACACGTTCGGAGAATTTTTTG-3′.SW480 and HCT116 cell lines were transfected with sh-aPKC-ι (3 μg/6-well) or control scramble shRNA (3 μg/6-well) using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instructions. Validation of the gene silencing was performed by quantitative real-time PCR.Wound healing assayCell migration ability was evaluated using wound healing assay as described in Gunaratne et al.[10]. Basically, SW480 or HCT116 cells were seeded in 6-well culture plates at 1.5 x 106 cells/well and incubated at 37 °C for 24 hours. Cells were then transfected by sh-aPKC-ι or pcDNA3.1-Rac1G12V plasmid for an additional 24- hour incubation. The plate was then scratched with a pipette tip to create a “wound”, and the cells were washed three times with PBS, followed by addition of 5% FBS-RPMI 1640 media. For ANF and TGF-β1 treatment, SW480 or HCT116 cells were seeded in 6-well culture plates (Corning, USA) at 1.5 x 106 cells/well. After incubation for 8 hours, cells were scratched with apipette tip. After three washes with PBS to remove the debris, cells were cultured in RPMI 1640 with0.5 μM ANF for 72 hours or with 10ng/ml TGF-β1 for 48 hours, as previously described[29, 30].Images of the wound were acquired before the scratch and at the indicated time after the scratch using an inverted microscope with digital camera. Width of the wound was calculated using Image J.Cell invasion of SW480 and HCT116 cell lines was further evaluated using transwell assay.

The assay was performed using modified Boyden chambers (Transwell, USA). Before the transwell assay, SW480 and HCT116 cell lines were transfected by pcDNA-Rac1, sh-aPKC-ι or sh-NC and then incubated for another 48 hours. Sixty micro- liter of 0.23 mg/ml Matrigel (Corning) was used to pre- coat the membranes on the upper chamber. The chamber was then incubated at 37°C, 5% CO2, for 2 hours to allow the gelling. After equilibrate the chambers with complete media for 1 hour, 30,000 cells were seeded into the upper chamber, which were allowed to migrate towards the lower chamber containing RPMI 1640 medium with 10% FBS. After incubation at 37°C for another 24 hours, cells were fixed with 4% paraformaldehyde for 30 min and stained with 1% crystal violet (Sigma). Then the number of cells was counted visually using a microscope in five different fields under ×200 magnifications per filter. Each experiment was performed in triplicate.For ANF treatment, the transwell assay was performed as described above, except that the culture medium in the lower chamber were replaced by RPMI 1640 medium with 10% FBS and 0.5 μM ANF.Total RNA was extracted from cell samples using TRIzol RNA isolation reagents (Invitrogen, CA, USA) and 1 µg of RNA was reverse-transcribed at 48°C for 30 min using a Superscript IV reverse transcriptase (Applied Biosystems). Quantitative real-time PCR (q-PCR) was performed using AppliedBiosystems 7500 Real- Time PCR System (ABI, USA) as described in Yang et al. [31] Cytosolic and nuclear extracts of the cancer cells were prepared as described in Wu et al. [32]. Briefly, trypsinized cells were washed in cold Ca2+- and Mg2+-free PBS and re-suspended in HLB buffer with protease inhibitors for 15 min on ice.

The cells were homogenized and centrifuged at 1,000 x g, 4°C for 1 hour. The supernatant was stored at -80°C until use. For the nuclear extracts, the pellet was washed with HLB buffer twice and then extracted with nuclear extraction buffer and stored at -80°C until use. Cell lysates or nuclear extracts were prepared in 1 x SDS lysis buffer, and boiled for 10 min. Protein contents were then determined using BCA Protein Assay Reagent (Pierce, USA). After being diluted with 1 x lysis buffer, equal amount of protein was loaded onto SDS-polyacrylamide gels (12% acrylamide in separating gel and with 5% in stacking gel) and separated by electrophoresis. Proteins were then transferred to nitrocellulose membranes. After blocking in 5% skimmed milk in PBS at 4°C overnight, membranes were incubated with anti-aPKC-ι antibody (1:250, #5584, Cell Signaling Technology, USA), anti- E-cadherin antibody (1:500, 20874-1-AP, ProteinTech Group, USA), anti-vimentin antibody (1:500, 10366-1-AP, ProteinTech Group, USA), anti-β-actin antibody (1:1000,A5316, Sigma, USA), anti- Rac1 antibody (1:500, ab33186, Abcam, USA), anti-phospho-c-Jun NH2-terminal kinase (JNK) antibody (1:250, #9251, Cell Signaling Technology, USA), anti-JNK antibody (1:500, #4672, Cell Signaling Technology, USA), anti-phosphorylated STAT3 (p-STAT3) antibody (1:250, #98543, Cell Signaling Technology, USA), anti-STAT3 antibody (1:500, ab31370, Abcam, USA), anti- lamin B1 antibody (1:1000, ab16048, Abcam, USA), anti-β-catenin antibody (1:500, ab16051, Abcam, USA) or β-actin antibody(1;3000, ab8226, Abcam, USA) for 2 hours. They were then incubated with either goat anti-rabbit IgG (1:2000, ab6721, Abcam, USA) or goat anti- mouse IgG (1:3000, ab97265, Abcam, USA), correspondingly. Protein signals were then visualized using Gel Doc XR+ gel documentation system (Bio-Rad, USA).Activity of Rac1 was measured using an EZ-detect Rac1 kit (Pierce Biotechnology) as described in Shen et al.[33]. Basically, cells were firstly transfected by sh-aPKC-ι or treatment with 0.5 μM for 48 hours. The cells were then lysed in lysis buffer (Pierce, USA) containing protease inhibitor cocktail, and the supernatant was collected by centrifugation at 16,000 x g, 4°C for 15 min. Activated Rac1 was then precipitated with glutathione S-transferase and detected by western blot. Statistical analysis was performed using Graphpad Prism 5. Student t test was used to compare means between two groups, while one-way ANOVA followed by Tukey’s comparison analysis was used to compare multiple groups. *P < 0.05, **P < 0.01 was considered statistically significant.

Results
We firstly investigated the aPKC-ι expression in two CRC cell lines (SW480 and HCT116) after being treated by 10ng/ml TGF-β1, an EMT inducer in cancer cells[34]. As shown in Figure 1A, both SW480 and HCT116 cell lines have transformed from epithelial phenotype to mesenchymal phenotype, after treatment of TGF-β1 for 72 h. In addition, both mRNA and protein expression of E-cadherin was decreased while the mRNA and protein level of vimentin, Snail and N-cadherin were significantly increased after the TGF-β1 treatment (Figure 1B & 1C). Moreover, the mRNA and protein expression of aPKC-ι was increased by nearly two folds after the TGF-β1 treatment (Figure 1B & 1C), indicating a possible association between aPKC-ι and EMT of CRC cells.In order to further investigate the effect of aPKC-ι on the cell migration and invasion, we further knocked down the expression of aPKC-ι using shRNA in both SW480 and HCT116 cell lines. The results showed that the expression levels of aPKC-ι were decreased after shRNA knockdown (Figure 2A & 2B). In addition, the expression level of E-cadherin was increased, while expression levels of vimentin, Snail and N-cadherin were decreased in both mRNA and protein, compared to control and sh-NC groups (Figure 2A & 2B). Wound healing assay showed a slower healing after the knockdown of aPKC-ι, compared to control in both cell lines at 72 hours (SW480: P < 0.05; HCT116: P < 0.01, Figure 2C). Transwell assay showed that the number of invaded cells were less in aPKC-ι knockdown group compared to control (SW480: P < 0.05; HCT116: P < 0.01, Figure 2D). Both wound healing test and transwell assay results indicated an inhibited capability of migration and invasion of those CRC cell lines after the knockdown of aPKC-ι.Knockdown of aPKC-ι inhibited TGF-β1-induced EMT, cell migration and invasionAs shown in Figure 3A, TGF-β1-induced EMT of HCT116 and SW480 cell lines was inhibited by knockdown of aPKC-ι. Similarly, knockdown of aPKC-ι also inhibited the promoting effects of TGF- β1 on vimentin, N-cadherin, and Snail expression, as demonstrated in both mRNA and protein levels, accompanied with increased E-cadherin production (Figure 3B & 3C). Wound healing assay and transwell assay showed that aPKC-ι knockdown inhibited the TGF-β1- induced cell migration and invasion in both HCT116 and SW480 cell lines (Figure 3D & 3E).

Knockdown of aPKC-ι decreased the activation levels of Rac1 and the downstream signaling factors, JNK, STAT3, and nuclear accumulation of β-cateninWe then investigated the downstream signaling factors of aPKC-ι. As shown in Figure 4A, in both SW480 and HCT116, levels of activated Rac1 (Rac-GTP) were decreased in aPKC-ι-knockdown groups (SW480: P < 0.05; HCT116: P < 0.05). In addition, inhibited Rac-1 activation was accompanied with decreased activation of JNK (p-JNK) in both cell lines, which was decreased by nearly 50% compared to control in SW480. Furthermore, the expression of phosphorylated STAT3 significantly down-regulated in both SW480 and HCT 116 with aPKC-ι knockdown (SW480: P < 0.05; HCT116: P < 0.05, Figure 4B), and the nuclear levels of β-catenin were also decreased in aPKC-ι- knockdown groups, while its cytoplasmic levels were increased (Figure 4C). Those results suggest that knockdown of aPKC- may inhibit the phosphorylation of STAT3 and control the localization of - catenin through inhibiting Rac1-JNK pathway.To elucidate if the effect of aPKC-ι on CRC cell EMT, migration and invasion is Rac-1 dependent, we transfected the pcDNA-Rac1G12V plasmid into aPKC-ι knockdown cells. As shown in Figure 5A-5B, expression of Rac1-GTP was increased by 2-3 folds in HCT116 and SW480 cell line after overexpressing Rac1G12V gene. After the overexpression of Rac1-GTP, both CRC cell lines showed more mesenchymal phenotype and less epithelial phenotype under microscope compared to control, indicating that Rac-1 overexpression partially recovered the inhibited EMT of CRC cell lines by aPKC- ι knocked-down (Figure 5C). The results of wound healing assay and transwell assay showed a partial recovery of the inhibited effect of aPKC-ι knock-down on cell migration and invasion ability in CRC cells (Figure 5D & 5E).

Overall, those results indicate that aPKC-ι inhibited the migration and invasion of CRC cells partially via the inhibition of Rac1 pathway.In order to further understand the role of aPKC-ι in EMT and metastasis of CRC, we also treated CRC cell lines with an aPKC-ι inhibitor, ANF, and investigated the changes in the EMT, invasion and migration of CRC cell lines. We firstly evaluated the cytotoxicity of ANF on HCT116 and SW480 cell lines, and results showed decreased cell survival with the increase in the concentration of ANF (Figure 6A), with IC50 near 0.5 μM. Based on the results of ANF cytotoxicity evaluation, we used 0.5 μM ANF in the subsequent experiments. As shown in Figure 6B and 6C, 0.5 μM ANF slightly decreased the expression levels of aPKC-ι in both CRC cell lines. However, expression of vimentin was significantly deceased, together with an increase in E-cadherin expression levels (Figure 6C), indicating that EMT of those cell lines could be inhibited by ANF. Wound healing assay and transwe ll assay showed a slowed healing and decreased number of invasion cells after treatment with ANF, indicating that ANF could inhibit the invasion and migration of CRC cells (Figure 6D & 6E).On the presence of 0.5 μM ANF, levels of Rac1-GTP were decreased by nearly 50% in both cell lines (Figure 7A), together with decreased levels of phosphorylated JNK (SW480: P < 0.05; HCT116: P < 0.05), and the downstream p-STAT3 was also down-regulated compared to control groups (SW480: P< 0.05; HCT116: P < 0.01, Figure 7B). In addition, nuclear levels of β-catenin were shown to be decreased, while its cytoplasmic levels were increased, on the presence of ANF ( Figure 7C). Those results indicate that ANF could inhibit the aPKC- expression and also the activation of its downstream signaling factor, including Rac1, JNK and STAT3. Nuclear translocation of β-catenin was also restrained by ANF.

Discussion
In this study, we have investigated the relationship between aPKC-ι expression level and EMT, migration and invasion of CRC cell lines. After treatment by TGF-β1, an EMT inducer[34], we have observed a successful transition from epithelial phenotype to mesenchymal phenotype in CRC cell lines, both morphologically (from a more polarized epithelial morphology to a more non-polarized mesenchymal morphology, Figure 1A) and by molecular biomarkers (Figure 1B & 1C). In those TGF-β1-treated CRC cell lines, expression of aPKC-ι was increased in both mRNA and protein levels (Figure 1B & 1C), which is consistent with the previous findings that aPKC-ι plays a role in the EMT of cancer[16]. We further knocked down the expression of aPKC-ι in CRC cell lines, and observed increased expression of E-cadherin and decreased expression of vimentin, Snail, N-cadherin and decreased ability to migrate and invade (Figure 2). In addition, aPKC-ι knock-down also inhibited the TGF-β1-induced EMT, cell migration and invasion in CRC cell lines (Figure 3). Those findings further confirmed the role of aPKC-ι in the EMT, migration and invasion of CRC cell lines.Previous studies have found that aPKC-ι drove the transformed growth of NSCLC by activating Rac- 1[10, 35]. Similarly, decreased activated Rac-1 (Rac-1-GTP) levels were also observed when aPKC-ι was knocked down in our study (Figure 4A). In addition, study by Wu et al. found that activated Rac-1 could promote the nuclear translocation of p-STAT3 and β-catenin which was mediated by JNK [32]. In our study, the downstream pathway factors of Rac1, including JNK, STAT3 and β-catenin, showed decrease in their activated forms, p-JNK, p-STAT3 and nuclear β-catenin, in aPKC-ι-knockdown CRC cell lines (Figure 4B&4C). In addition, Rac-1 over-expression has partially rescued the inhibition of EMT, cell migration and invasion by aPKC-ι knockdown in CRC cell lines (Figure 5). Those results indicate that similar to NSCLC, aPKC-ι may also promote the EMT of CRC via Rac1 pathway.

ANF is a member of a group of anti-rheumatoid arthritis drugs which were widely studied for their potential usage in other diseases, including cancer[22]. Members of this group of drugs have been found to be able to inhibit the EMT of cancer cells through inhibition of aPKC-ι, e.g. aurothiomalate (ATM) in pancreatic cancer[20] and HCC[17], aurothioglucose (ATG) in NSCLC[21], and ANF was also shown to inhibit PKC-ι signaling in ovarian cancer[36]. Since ATM and ATG are no longer available for clinical usage, we instead evaluated the effect of ANF and its possible role in CRC treatment. Although only slightly decreasing the expression level of aPKC-ι, ANF showed similar inhibition on the EMT, migration and invasion of CRC cell lines (Figure 6) as aPKC-ι knockdown (Figure 2). These data could be partially explained by the previous findings by Wang et al. that ANF could inhibit aPKC-ι by influencing the interaction between aPKC-ι and Par6, while no inhibition on aPKC-ι expression were observed in ovarian cancer cells[36]. In addition, the results showed that similar to the results of aPKC-ι knockdown, ANF also inhibited the activation of downstream signaling factors of the aPKC-ι-Rac1-JNK pathway (Figure 7). All those results indicate that ANF could inhibit the EMT, migration and invasion of CRC cell lines via inhibition of aPKC-ι and the downstream Rac1- JNK pathway.

Conclusions
In conclusion, this study demonstrated that aPKC-ι plays important roles in the EMT, migration and invasion of CRC cell lines. By activating Rac-1, aPKC-ι could facilitate the phosphorylation of the downstream signaling factor, JNK, which then promotes the phosphorylation of STAT3 and nuclear translocation of β-catenin, eventually leading to the EMT, migration and invasion of CRC cells. As an inhibitor of aPKC-ι, ANF could inhibit the EMT, migration and invasion of CRC cells by inhibiting the activation of aPKC-ι-Rac1-JNK pathway, which could serve as a potential drug for early prevention of CRC metastasis. Future studies would be Auranofin required to further investigate the role of aPKC-ι in in vivo metastasis of CRC, as well as the possible role of aPKC-ι knockdown in CRC treatment.