After 3 days, the cells were split 110 and reseeded in the presence of inhibitors. On day 6, cell culture growth/viability was monitored by MTS sellckchem assay. Relative growth, compared to vehicle-treated controls, was used to calculate the fraction affected and the combination index for each experimental combination, using the CalcuSyn software. Western blotting The cells were harvested, washed with ice-cold PBS and resuspended in lysis buffer as described [19]. Total cell extracts were loaded on SDS-PAGE, transferred to a nitrocellulose membrane and probed with the indicated primary antibodies overnight at 4��C. Proteins were revealed by chemiluminescence after incubation with HRP-conjugated secondary antibodies (GE Healthcare, diluted 12500). Soft-agar colony assay Ten thousand cells were embedded in RPMI containing the indicated compounds and 0.
3% low-melting agarose type VII (Sigma-Aldrich) and seeded on top of a 0.5% agarose/RPMI support layer in 6-well plates. Fresh inhibitors were added every 7 days to the top agar layer. The colonies were counted after 20 days. Quantitative real-time PCR Cells were treated with vehicle or inhibitors for 24 or 72 hours and harvested. Total RNA was extracted with TRIzol reagent (Invitrogen) and retrotranscribed with random hexamers using a standard procedure. For the 96-well array gene set, forward and reverse primer mix (5 pmol each) was spotted in the corresponding well for each target gene and the plates were kept frozen at ?80��C until needed.
The reaction mix (2 ��l cDNA, 10 ��l Brilliant III Ultra-Fast SYBR? Green QPCR Master Mix and 7 ��l water, per well) was added to the pre-made plates and quantitative PCR was run on a Stratagene MX3000P detection system, under the following conditions: 95��C, 3 min (1 cycle); 95��C, 10 sec, 60��C, 20 sec (40 cycles). The confirmation run was performed in triplicate using the standard real time PCR protocol recommended by the manufacturer. The GAPDH housekeeping gene was always used as an internal reference. Primers for GAPDH were TGCACCACCAACTGCTTAGC (forward) and GGCATGGACTGTGGTCATGAG (reverse). The primers for all other genes are listed in the Table S2. Results PKF115-584 (figure 1A) and pyrvinium pamoate (figure 1B) have been shown to interfere with the ��-catenin-associated transcriptional complex through different mechanisms.
In order to verify the activity of the two drugs in CRC cells, we characterized their effects in the Ls174T cell line, carrying ��-catenin and KRAS activating Dacomitinib mutations [30], [33]. This cell line was initially chosen as a model because it was previously used to characterize the effects of siRNA-mediated gene silencing [19]. As reported in figure 1D�CE, both drugs inhibited cell growth in a dose-dependent manner. Similar growth inhibition was obtained in DLD-1 cells, which express a truncated APC allele (figure S1A�CB).
No related posts.