For some primer combinations it was necessary MAPK inhibitor to increase the annealing temperature to 62°C to get a more specific product (pri-132). The mature miR-219 is generated from two genes, miR-219-1 and miR-219-2. We were unable to amplify the precursor of miR-219-1, possibly due to its extremely low abundance, and therefore focused our analysis on miR-219-2. Changes in relative concentration were calculated as the difference in threshold cycles (ΔCT) between the left dentate gyrus (experimental) and
right dentate gyrus (control). ΔCT was calculated by subtracting the CT of the housekeeping gene from the CT of the gene of interest. Fold change was generated using the equation 2−ΔΔCT. Student’s t-test was used dendate gyrus for statistical analysis. At the end of LTP recordings rats were intracardially perfused with 4% paraformaldehyde (PFA).
The brain was removed and submerged sequentially in 4% PFA for 24 h at 4°C and 30% sucrose for 48 h at 4°C. On the following day the brains were frozen in CO2 gas, and 30-μm-thick coronal sections were cut on a Leica CM3050S Hedgehog inhibitor cryostat using Richard-Allan Sec5e blades. Sections were immediately stored in phosphate buffer containing 0.1% azide at 4°C. For primary miRNA in situ hybridization, riboprobes were prepared from genomic rat DNA using the following PCR primers; fw-212-cluster 5′gaggggacctgagaagcag3′ and bw-212-cluster 5′gctctgtatctgcccaaacc3′, and cloned into the pCR®II-TOPO® vector (Invitrogen). The Arc RNA probe was prepared from a cDNA insert matching the first 2975 nucleotides of the Arc mRNA (GenBank accession number NM-019361) and cloned into the pCR®II-TOPO® vector. Antisense and sense probes were transcribed from linearized plasmids using T7 and SP6 polymerase in the presence of digoxigenin (DIG) labeling mix Reverse transcriptase (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer’s instructions. In situ hybridization was performed on 30-μm-thick floating sections, as described previously (Wibrand et al., 2006). Visualization was done either with the chromogenic substrates nitro blue-tetrazolium-chloride and 5-bromo-4-chloro-indolyl-phosphate
(Roche) or with a fluorescent alkaline substrate (Fast Red Tablets; Roche). In situ hybridization of mature miRNA was performed using locked nucleic acid (LNA) probes, as previously described (Pena et al., 2009). In tissues fixated with PFA only, significant amounts of mature miRNAs are released and diffuse out of the tissue during the in situ hybridization procedure. This is avoided by adding a fixation step with 1-ethyl-3-(3-dimethyl-aminonpropyl) carbodiimide (EDC). Unlike formaldehyde, EDC reacts with the 5′ phosphate end of the miRNA, condensing it with the protein matrix to form stable linkages. Short oligo probes with LNA modifications are commonly used for the detection of mature miRNAs in Northern blots and during in situ hybridization (Kloosterman et al., 2006; Obernosterer et al., 2007).
No related posts.